classical monocyte isolation kit human miltenyi biotec (Miltenyi Biotec)

Miltenyi Biotec is a verified supplier

Miltenyi Biotec manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Miltenyi Biotec classical monocyte isolation kit human miltenyi biotec
Classical Monocyte Isolation Kit Human Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 182 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+miltenyi/Classical+Monocyte+Isolation+Kit%2C+human/pm42814571-693-221-226
Average 96 stars, based on 182 article reviews

classical monocyte isolation kit human miltenyi biotec - by Bioz Stars, 2026-10

96/100 stars

Images

Recombinant:

Article Title: Regulatory T cell stability determines the efficiency of bile duct regeneration during cholangitis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant Mouse TNF-α BioLegend 575204 Recombinant Mouse IFN-γ BioLegend 575304 Recombinant Mouse IL2 Peprotech 575402 Cell Activation Cocktail (without Brefeldin A) BioLegend 423302 Brefeldin A Solution (1,000×) BioLegend 420601 Monensin Solution (1,000×) BioLegend 420701 Opal 570 Reagent Pack Akoya FP1488001KT Opal 620 Reagent Pack Akoya FP1495001KT Opal 690 Reagent Pack Akoya FP1497001KT Opal 780 Reagent Pack Akoya FP1501001KT ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit Vector Laboratories MP-7401 VECTASTAIN® Elite® ABC-HRP Reagent, Peroxidase, R.T.U. (PK-7100) Vector Laboratories PK-7100 DAB Substrate Kit, Peroxidase (HRP), with Nickel, (3,3 ′ -diaminobenzidine) (SK-4100) Vector Laboratories SK-4100 Fluoromount-G TM Mounting Medium Invitrogen 00-4958-02 Protein Block Abcam ab64226 Dynabeads TM Human T-Activator CD3/CD28 for T cell Expansion and Activation Gibco 11161D Percoll, pH 8.5–9.5 Sigma P1644-500ML Recombinant Human IL-2 (carrier-free) BioLegend 589104 Human OX40 Ligand (soluble) Recombinant Protein PeproTech 310-28-10UG CD4 + CD25 + CD127dim/- Regulatory T cell Isolation Kit II, human Miltenyi 130-094-775 True-Phos Perm Buffer Biolegend 425401 Critical commercial assays RNeasy Mini Kit Qiagen 74104 QuantiTect Rev. .. Transcription Kit Qiagen 205311 MojoSort TM Mouse CD4 + CD25 + Regulatory T cell Isolation Kit BioLegend 480137 Deposited data Bulk RNA sequencing data of isolated EpCAM+ cholangiocytes GSE303970 https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE303970 Experimental models: Cell lines Cholangiocyte cell line Previous study (Lu et al. 1 ) Grown in House Experimental models: Organisms/strains Foxp3DTRGFP mice The Jackson Laboratory 016958 Foxp3 CreERT2 Ai14 mice By crossing Foxp3CreERT2 mice (JAX 016961) with Ai14 reporter mice (JAX 007914) Bred in House Oligonucleotides Cdkn1a CCTGGTGATGTCCGACCTG CCATGAGCGCATCGCAATC Ocln TGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG Tjp1 GCCGCTAAGAGCACAGCAA GCCCTCCTTTTAACACATCAGA Ppia Qiagen QT00247709 Krt19 Qiagen QT00156667 Sox9 Qiagen QT00163765 (Continued on next page) 18 Cell Reports 44, 116557, November 25, 2025

Article Title: c-JUN enhances CRISPR knockin anti-B7-H3 CAR T cell function in small cell lung cancer and thoracic SMARCA4-deficient undifferentiated tumors.
Article Snippet: Cas9 protein IDT Cat# 1072532 CTS TM Xenon TM Genome Editing Buffer Thermo Fisher Scientific Cat# A4998001 Electroporation Buffer, Small MaxCyte Cat# EPB-1 Nexcelom Bioscience Llc AO/PI Viability stain 5mL Fisher Scientific Cat# NC0285242 (Continued on next page) Cell Reports Medicine 7, 102549, January 20, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Corning TM Matrigel TM Matrix Fisher Scientific Cat# CB-40234 eBioscience TM 1× RBC Lysepuffer BD Biosciences Cat# 00-4333-57 Cisplatin Fluidigm Cat# 201064 Q TM Four Element Calibration Beads Fluidigm Cat #201078 Cell-ID TM Intercalator-Ir Standard BioTools Cat. #201192B MAXPAR Cell Staining Buffer (CSB) Standard BioTools Cat. #201068 MAXPAR Fix/Perm Buffer Standard BioTools Cat. #NC0987611 Fresolilumab Selleckchem Cat. #A2336 Biotinylated Human B7-H3/CD276 Protein, Fc,Avitag TM (MALS verified) Acro Biosystems Cat. #B73-H82F5 Recombinant Human TGF-beta 1 Protein R&D Systems TM Cat. #18339417 Critical commercial assays Human IFN-g ELISA MAX Deluxe BioLegend Cat #430104 Human IL-2 ELISA MAX Deluxe BioLegend Cat #431804 Intracellular Fixation & Permeabilization Buffer Set Kit BD Biosciences Cat #88-8824-00 Dylight 650 Micoscale Antibody Labeling Kit Thermo Fischer Scientific Cat #84536 RosetteSep Human T cell Enrichment Cocktail STEMCELL Technologies Cat #15061 SepMate-50 Tubes STEMCELL Technologies Cat #85450 REAlease® CD4/CD8 (TIL) MicroBead Kit, human Miltenyi Cat #130-121-561 RNeasy Micro kit Qiagen Cat #74104 Maxpar® X8 Multimetal Labeling Kit Standard BioTools Cat #201300 LEGEND MAX TM Free Active TGF-β1 ELISA Kit BioLegend Cat #437707 PureLink Genomic DNA Mini Kit Invitrogen Cat #K182001 ddPCR Supermix for probes (no dUTP) BioRad Cat. #1863024 Deposited data Human SCLC processed RNA-Seq data George et al. 2 https://doi.org/10.1038/nature14664. ..

Article Title: Perfusion microbioreactor for CAR-Treg manufacturing
Article Snippet: .. Jo urn al Pr e-p roo f Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Brilliant Violet 605TM anti-human CD4 Antibody (SK3) Biolegend Cat#344645 PE anti-human CD25 Antibody (BC96) Biolegend Cat#302605 PE/Cyanine7 anti-human CD69 Antibody (FN50) Biolegend Cat#310911 Brilliant Violet 785TM anti-human CD127 (IL7Rα) Antibody (A019D5) Biolegend Cat#351329 PE anti-human HLA-A2 Antibody (BB7.2) Biolegend Cat#343305 Alexa Fluor® 647 anti-human FOXP3 Antibody (206D) Biolegend Cat#320113 Brilliant Violet 510TM anti-human Ki-67 Antibody (11F6) Biolegend Cat#350517 PerCP/Cyanine5.5 anti-human CD152 (CTLA4) Antibody (BNI3) Biolegend Cat#369607 Bacterial and virus strains HLA-A2 CAR second-generation pLNT/SSFV Boardman et al.3 N/A Biological samples Peripheral blood leukocyte cones NHSBT Tooting Cat#NC24 Chemicals, peptides, and recombinant proteins CellTraceTM Violet Cell Proliferation Kit ThermoFisher Cat#C34557 DynabeadsTM Human T-Activator CD3/CD28 Gibco Cat#11131D T Cell TransActTM, human Miltenyi Cat130-111-160 RosetteSepTM Human CD4+ T Cell Enrichment Cocktail Stemcell Cat#15062 LymphoprepTM Stemcell Cat#18060 Jo urn al Pr e-p roo f CD25 MicroBeads II, human Miltenyi Cat#130-092-983 LS columns Miltenyi Cat#130-042-401 Recombinant Human IL-2 Protein R&D Systems Cat#202-IL Rapamycin LC Laboratories Cat#R5000200M G PEG-itTM System Biosciences Cat#LV810A-1 LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit ThermoFisher Cat#L34975 Critical commercial assays N/A N/A N/A Deposited data N/A N/A N/A Experimental models: Cell lines SPO (HLA-A2+DR11+) B-LCLs Boardman et al.3 N/A BM21 (HLA-A2−DR11+) B-LCLs Boardman et al.3 N/A Experimental models: Organisms/strains N/A N/A N/A Oligonucleotides N/A N/A N/A Recombinant DNA N/A N/A N/A Software and algorithms FlowJo FlowJo https://www.flowj o.com/flowjo/dow nload Jo urn al Pr e-p roo f Prism GraphPad https://www.grap hpad.com/feature s Leica LasX Leica Microsystems https://www.leica- microsystems.com /products/microsc ope- software/p/leica- las-x- ls/downloads/ Other N/A N/A N/A Jo urn al Pr e-p roo f ..

Activation Assay:

Polymer:

Blocking Assay:

Cell Isolation:

other:

Article Title: CD4 T cells convert transient responses to KRAS inhibition to durable remissions in pancreatic cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Human IFNγ ELISA Biolegend Cat# 430107 MRTX1133 Mirati Therapeutics and Bristol Myers Squibb CAS No. 2621928-55-8 Adagrasib Mirati Therapeutics and Bristol Myers Squibb MRTX-849; CAS No. 2326521-71-3 RMC-6236 MedchemExpress Cat# HY-148439; CAS No. 2765081-21-6 Captisol Cydex Pharmaceuticals A Ligand Company Cat# RC-0C7-100; CAS No. 182410-00-0 Citrate buffer Teknova Cat# Q2443 Gemcitabine NovaPlus NDC: 00409-0182-01 n(ab)paclitaxel(Abraxane) Celgene NDC: 68817-134-50 TLR7 agonist(Imiquimod) MedChemExpress HY-B0180; CAS No. 99011-02-6 LCL161 MedChemExpress Cat# HY-15518 Fluorouracil Fresenius Kabi NDC: 63323-117-59 Oxaliplatin Sandoz NDC: 00781-3315-70 Leucovorin calcium injection Fresenius Kabi NDC: 63323-710-50 Irinotecan hydrochloride injection Hikma NDC: 0143-9702-01 G-CSF (filgrastim) Neupogen NDC: 55513-924-91 21h10 Chun et al.29 N/A Neo2/15 Quijano-Rubio et al.35; Silva et al.36 N/A Trypsin Life Technologies Cat# 25200114 Protease and phosphatase inhibitor Sigma Cat# 11836170001 BCA Assay kit Life Technologies Cat# 23225 Dispase Life Technologies Cat# 17105041 Collagenase P Sigma Cat# 11249002001 DNase I Sigma Cat# 10104159001 hIL-2 Peprotech Cat# 200-02 STEMCELL EasySep CD4 Negative Selection Kit STEMCELL Cat# 19852 STEMCELL EasySep CD90.2 Positive Selection Kit STEMCELL Cat# 18951 Brefeldin A eBioscience Cat# 00-4506-51 PMA ionomycin cocktail eBioscience Cat# 00-4970-93 Tumor dissociation kit, human Miltenyi Cat# 130-095-929 Critical commercial assays Human Cytokine/Chemokine 96-Plex Discovery Assay Array (HD96) Eve technologies https://www.evetechnologies.com/product/ new-human-cytokine-chemokine-96-plex- discovery-assay-array-hd96/ Mouse Cytokine/Chemokine 68-Plex Discovery Assay Array (MD68) Eve technologies https://www.evetechnologies.com/product/ mouse-cytokine-chemokine-68-plex- discovery-assay-array-md68/ Deposited data Loveless et al. data Loveless et al.49 https://zenodo.org/records/14199536 DFCI human single-cell RNA sequencing This paper dbGAP: phs004509.v1.p1 Mouse single-cell RNA sequencing This paper GEO: GSE307192 Experimental models: Cell lines Mouse: 6694c2 Ben Stanger (University of Pennsylvania); Li et al.32 RRID: CVCL_YM31 Mouse: 6694c2 β2m− /− Roehle et al.33 N/A 6694c2 Ciita− /− Kureshi et al.45 N/A (Continued on next page) ll OPEN ACCESS Cell 189, 1–17.e1–e7, November 25, 2026 e2 Article

Staining:

Multi-Angle Light Scattering:

Enzyme-linked Immunosorbent Assay:

Antibody Labeling:

Labeling:

RNA sequencing:

Virus:

Software:

Article Title: In vivo modeling of human γδ T cell ontogeny reveals terminal deoxynucleotidyl transferase as a key regulator of type 3 Vδ2 T cell development.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human term-delivery cord blood H.U.B – Hôpital Erasme and CHU Saint-Pierre N/A Human peripheral blood and mononuclear cells Blood transfusion center in Charleroi N/A Chemicals, peptides, and recombinant proteins Brefeldin A Sigma Cat#B6542 Phorbol-myristate-acetate Sigma Cat#79346 Ionomycin calcium salt Sigma Cat#I3909 Human IL-2, animal-free recombinant protein Peprotech Cat#AF-200-02 Zoledronic acid monohydrate Sigma Aldrich Cat#SML0223 4-hydroxy-3-methyl-but-2-enyl-pyrophosphate Sigma Aldrich Cat#95098 Human SCF recombinant protein Peprotech Cat#300-07-50UG Human Flt-3 Ligand (FLT3L) recombinant protein Peprotech Cat#300-19-50UG Human IL-6 recombinant protein Peprotech Cat#200-06-20UG Human TPO (Thrombopoietin) recombinant protein Peprotech Cat#300-18-10UG StemRegenin 1 Stemcell Technologies Cat#72342 UM-729 Stemcell Technologies Cat#72332 Alt-RTM S.p. .. Cas9 Nuclease V3 Integrated DNA Technologies Cat#1081059 Alt-RTM Cas9 Electroporation Enhancer Integrated DNA Technologies Cat#1075916 Critical commercial assays CD34 MicroBead Kit UltraPure, human Miltenyi Cat130-100-453 CD3 MicroBeads, human Miltenyi Cat#130-097-043 miRNeasy Micro Kit Qiagen Cat#217084 SuperScript II RT enzyme Invitrogen (ThermoFisher) Cat#18064014 AMPure XP beads for DNA Cleanup Beckman Coulter Cat#A63881 Platinum SuperFi II DNA Polymerase Invitrogen (ThermoFisher) Cat#12361050 Phire Animal Tissue Direct PCR Kit Invitrogen (ThermoFisher) Cat#F140WH Wizard® SV Genomic DNA Purification System Promega Cat#A2361 Wizard® SV Gel and PCR Clean-Up System Promega Cat#A9281 Deposited data Raw and processed data This paper GEO: GSE308703 Experimental models: Organisms/strains Mouse: NOD.Cg-KitW− 41JTyr+PrkdcscidIl2rgtm1Wjl/ThomJ The Jackson Laboratory RRID: IMSR_JAX:026622 Software and algorithms FlowJo v10.8.1 BD Biosciences https://www.flowjo.com/ MiXCR software version 3.0.13 Bolotin et al.58 https://github.com/milaboratory/mixcr VDJtools software version 1.2.1 Shugay et al.59 https://github.com/mikessh/vdjtools CRISPOR https://doi.org/10.1093/nar/gky354 https://crispor.gi.ucsc.edu/ Inference of CRISPR Edits (ICE) online tool (ICE CRISPR Analysis. ..

Electroporation:

Polymerase Chain Reaction:

DNA Purification:

CRISPR:

Inhibition:

Article Title: An African ancestry-enriched H1 sub-haplotype challenges MAPT haplotype assignment and reveals distinct tau regulatory programs.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER R v4.2.2 R Foundation https://www.r-project.org/ ImageJ Schneider et al.71 https://imagej.net/ij/ cutadapt Marcel et al.72 https://cutadapt.readthedocs.io/en/stable/ bowtie2 Langmead et al.73 https://github.com/benlangmead/bowtie2 samtools Li et al.70 http://www.htslib.org/ removeChrom.py Buenrostro et al.74 https://github.com/harvardinformatics/ATAC- seq/blob/master/atacseq/removeChrom.py WASP van de Geijn et al.75 https://www.encodeproject.org/software/ wasp/ MACS3 Zhang et al.76 https://macs3-project.github.io/MACS/ tssenrich PyPI Package https://gitlab.com/aaylward/tssenrich DiffBind Ross-Innes et al.77 https://bioconductor.posit.co/packages/3.20/ bioc/html/DiffBind.html edgeR Robinson et al.78 https://www.bioconductor.org/packages//2.7/ bioc/html/edgeR.html RUVSeq Risso et al.79 https://bioconductor.posit.co/packages/3.21/ bioc/html/RUVSeq.html Other Matrigel Corning Cat# 354230 BrainPhis StemCell technologies Cat# 05790 Neuronal Inducing Medium StemCell technologies Cat# 05839 CD133 MicroBead Kit, human Miltenyi Cat# 130-097-049 CD271 MicroBead Kit, human Miltenyi Cat# 130-099-023 Astrocyte media kit Sciencell Cat# 1801 Accutase Innovative Cell Technologies Cat# AT104 StemFlex ThermoFisher Scientific Cat# A3349401 N2 ThermoFisher Scientific Cat# 1750204 NEAA ThermoFisher Scientific Cat# 11140050 B27 without vitamin A ThermoFisher Scientific Cat# 12587010 glutamax ThermoFisher Scientific Cat# 35050061 Ascorbic acid Sigma Aldrich Cat# W210901 Releser StemCell Cat# 50-206-9324 cAMP Sigma Aldrich Cat# S-D0627-100MG BDNF R&D Cat# BT-248-BDB-010 GDNF R&D Cat# BT-212-GD-010 DMEM/F-12 with soduim pyruvate GlutaMAX ThermoFisher Scientific Cat# 10565018 penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 FGF2 R&D Cat# BT-FGFB-020 bambanker FisherSci Cat# NC2960954 ll OPEN ACCESSArticle Neuron 115, 1–17.e1–e12, March 3, 2027 e4 Neuronal and astrocyte differentiation protocols iPSCs were differentiated into neural progenitor cells (NPCs) and then neuronal cultures as previously described,81 this method is also referred to as Dual SMAD inhibition differentiation. .. Briefly, iPSC were seeded in Neuronal Inducing Medium (05839 StemCell technologies) to form Rosettes.

Review